Contributions to Zoology, 80 (1) – 2011Pawel Koperski; Rafal Milanowski; Agnieszka Krzyk: Searching for cryptic species in Erpobdella octoculata (L.) (Hirudinea: Clitellata): discordance between the results of genetic analysis and cross-breeding experiments

To refer to this article use this url: http://contributionstozoology.nl/vol80/nr01/a04

Material and methods

Field study

FIG2

Table 1. Morphological variability of E. octoculata expressed as a percentages of morphological forms and values of NPA index (percentage of non-pigmented area on the dorsal side of the body - see methods for details) in different types of freshwater habitats. The results of post-hoc comparisons (Tukey’s test) presented as a homogenic groups.

FIG2

Fig. 1. Morphological forms of Erpobdella octoculata. Schematic drawings of the dorsal side of the individuals’ body, presenting colouring patterns (grey - dark pigmented area, white - unpigmented area) on the post-clitelliar region: (a) form 1 - very dark, (b) 2 - dark, (c) 3 - medium, (d) 4 - light, (e) 5 - very light, (f) - individual of the form 2 with marked region of the body (somite 14-15) taken into consideration in the analysis.

A total of 583 individuals of E. octoculata were sampled between 2007 and 2009 in 18 freshwater environments in Poland: rivers, streams, channels, lakes and ponds, differing in terms of their bottom substrate (Table 1). Leeches were sampled manually from stones and with sweep-net from macrophytes and silt. Animals were preserved in 10% ethyl alcohol and after one hour in 80% ethyl alcohol. Selected animals were photographed under magnification c. 100 ×, alive and after preservation. On the basis of the photographic data-base, the sampled individuals were classified into five morphological forms (morphotypes), distinguished mainly on the basis of the area covered by dark pigment on the dorsal surface of the post-clitellar region (measured on somites 14-15) (Fig. 1a-f). These morphological forms are characterised as follows:

The differences between different types of environments and between different types of bottom substrates in proportion to particular morphological forms and in mean proportion of pigmented area on the dorsal surface were determined. Statistical significance of the differences in proportions was tested with Chi2 tests, while those in the mean pigment coverage of the body was tested with one-way ANOVA and post-hoc Tukey’s test.

Experimental mating

next section

Morphologically divergent individuals were bred in the laboratory during long-term experimental mating. 84 parent pairs (168 individuals) of dark, medium and very light forms, collected in lakes Łaśmiady and Wadąg and in the rivers Wisła (Vistula) and Święcek were allowed to reproduce in different combinations for 7 months (June-December). Each pair was separated in polypropylene, cylindrical containers, 0.25 dm3 in volume. A fragment of the wall in each container (20 cm2) was replaced with a plastic net with 1mm mesh-size. Each 10 containers were submerged in aquaria filled with circulating, filtrated and aerated water at the temperature of 20°C and with constant photoperiod of 16 hrs of light and 8 hrs of darkness. The animals were fed once in two days with live larvae of Chironomidae with regular addition of frozen Tubifex, Gammarus and fish meat.

The numbers of cocoons laid and number of hatchlings of each pair were counted. Young individuals were moved to another set of polypropylene containers with the volume of 0.25 dm3 with filtered water at the temperature of 20°C and with constant photoperiod of 16 hrs of light and 8 hrs of darkness. Young leeches were fed daily with live Enchytraeidae and small Chironomidae. The quantity of offspring of each pair which remained alive after 5 days was recorded. The morphological form of each young individual was determined as soon as it was (15-20 days after hatching). The significance of differences between values of demographic parameters were tested with Wilcoxon’s test. The number of cocoons with dead or no embryos was high, as well as mortality, which was high, mainly because of cannibalism.

Analysis of DNA sequences

The analysis of differences in sequences of two DNA regions was used to search for reproductive barriers between morphologically different individuals.

Mitochondrial sequences of COI (cytochrome oxydase subunit I) of 601 nucleotides in length and ribosomal sequences of the block ITS1/5.8S/ITS2 of 688 nucleotides in length were analysed for 15 individuals of 4 morphological forms (light, medium, dark and very dark) collected in 4 freshwater environments. The sequences of one individual of Erpobdella nigricollis (Brandes, 1900) and one individual of E. vilnensis (Liskiewicz, 1925) were also analysed as outgroups.

To quantify the differences between individuals, differing in morphology and collected in various geographical areas of Poland, their genetic sequences obtained with the AP-PCR method (Arbitrary Primers PCR) were analysed. This group of methods has been commonly used in analysis of intra-population genetic variability of different aquatic invertebrates (e.g. Chambers et al., 1998; Zhou et al., 2005). Polymorphism in 24 primers constructed on the basis of primers presented for Macrobdella decora (Say, 1824) was tested. Totally 24 individuals of 4 morphological forms (light, medium, dark and very dark) collected in 5 freshwater environments (lake Wadąg and the rivers Wieprz near Zwierzyniec, Odra near Kostrzyń, Wisła in Warsaw and Święcek near Drygały) were analysed. Geographical distance between those environments ranged between 100 km (distance from Wadąg to Święcek) to 700 km (distance from Odra to Wieprz) (Fig. 2).

FIG2

Fig. 2. Map of Poland with the marked sites (black circles) where individuals were sampled from for analysis of genetic similarities with AP-PCR method.

The total DNA was isolated from a piece of muscle tissue (approx. 50 mg) by using the DNeasy Kit (Qiagen, Hilden, Germany) in accordance with the manufacturer’s protocol. The exact DNA concentration was measured for each probe using a NanoDrop spectrophotometer (NanoDrop, Wilmington, USA).

The primer pair LCO1490 (GGTCAACAAATCATAAAGATATTGG) and HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) was used to amplify a fragment of the COI gene; details of the PCR amplification are provided in Hebert et al. (2003).

The second primer pair N-nc18S10 (AGGAGAAGTCGTAACAAG) and C26A (GTTTCTTTTCCTCCGCT) was used to amplify the entire ITS1-5.8S-ITS2 region (Wen and Zimmer, 1996). A 25 μl reaction mixture contained 0.5 U Taq polymerase (Qiagen), 0.2 mM dNTPs, 2.5 mM MgCl2, 5 pmol each primer, reaction buffer (Qiagen) and 20 ng DNA. The PCR protocol consisted of 5 min of denaturation at 94°C, followed by 35 cycles comprising 1 min at 94°C, 1 min at 52°C and 1 min at 72°C. The final extension step was performed for 7 min at 72°C. Each PCR product was electrophoresed in a 1.5% agarose gel, stained with ethidium bromide, then excised and purified using a QIAEXII Gel Extraction Kit (Qiagen). PCR products were sequenced from both strands by cycle sequencing using BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA). The readings from ABI Prism 3730 DNA sequenator, after removal of primer sequences, were assembled into contigs by the SeqMan program of the Lasergene package (DnaStar, Madison, WI, USA) and checked manually for consistency.

In total 24 primers designed for amplification of 12 microsatellite loci in Macrobdella decora (Budinoff et al., 2004) were tested in Arbitrarily Primers PCR. A 25 μl reaction mixture contained 0.5 U Taq polymerase (Qiagen), 0.2 mM dNTPs, 4 mM MgCl2, reaction buffer (Qiagen), 20 ng DNA and 10 pmol single primer. The PCR protocol (Welsh and McClelland, 1991; modified) consisted of 5 min of denaturation at 94°C, followed by 2 low stringency cycles comprising 2 min at 94°C, 5 min at 40°C and 2 min at 72°C, then by 35 high stringency cycles comprising 1 min at 94°C, 1 min at 40°C and 2 min at 72°C. The final extension step was performed for 7 min at 72°C. AP-PCR products were separated in 2% agarose gel, stained with ethidium bromide, photographed under UV light and analysed.

Genetic similarity between individuals was compared on the basis of AP-PCR products. After removing of all non-informative products (the ones that are present or absent in all individuals) a data-base of 97 products from 9 loci for 24 individuals was created. To calculate genetic similarity between individuals numerical values 0, 1 or 2 were assigned. Value 2 was assigned for the presence of pair of bars in individuals (homozygotic), the lack of any bar of the pair was denoted as value 0 (homozygotic) and the presence of only one bar of the pair (heterozygotic) denoted as 1. Genetic similarity between individuals was determined with UPGMA (Statistica 6) and results were presented as a genetic distance biplot of Multidimentional Scaling based on the UPGMA matrix of similarity. The regression coefficient for the relation of the geographical distance between sampling sites and the genetic distance was calculated with Microsoft Office Excel 7.0 software. The genetic distance between groups of individuals (within particular morphological forms and environments as well as between forms and environments) was tested with T test (Statistix 9).